ID: 985798660

View in Genome Browser
Species Human (GRCh38)
Location 5:1985905-1985927
Sequence CAGGGCCAGGACAGCATCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985798660_985798662 -10 Left 985798660 5:1985905-1985927 CCATCGATGCTGTCCTGGCCCTG No data
Right 985798662 5:1985918-1985940 CCTGGCCCTGAGCTTCTCTCTGG No data
985798660_985798666 -2 Left 985798660 5:1985905-1985927 CCATCGATGCTGTCCTGGCCCTG No data
Right 985798666 5:1985926-1985948 TGAGCTTCTCTCTGGGCTGCTGG No data
985798660_985798667 -1 Left 985798660 5:1985905-1985927 CCATCGATGCTGTCCTGGCCCTG No data
Right 985798667 5:1985927-1985949 GAGCTTCTCTCTGGGCTGCTGGG No data
985798660_985798668 3 Left 985798660 5:1985905-1985927 CCATCGATGCTGTCCTGGCCCTG No data
Right 985798668 5:1985931-1985953 TTCTCTCTGGGCTGCTGGGTAGG No data
985798660_985798663 -9 Left 985798660 5:1985905-1985927 CCATCGATGCTGTCCTGGCCCTG No data
Right 985798663 5:1985919-1985941 CTGGCCCTGAGCTTCTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985798660 Original CRISPR CAGGGCCAGGACAGCATCGA TGG (reversed) Intergenic
No off target data available for this crispr