ID: 985798662

View in Genome Browser
Species Human (GRCh38)
Location 5:1985918-1985940
Sequence CCTGGCCCTGAGCTTCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985798656_985798662 18 Left 985798656 5:1985877-1985899 CCCAGCAGATGCTCCAGGTGGAC No data
Right 985798662 5:1985918-1985940 CCTGGCCCTGAGCTTCTCTCTGG No data
985798658_985798662 5 Left 985798658 5:1985890-1985912 CCAGGTGGACTTTATCCATCGAT No data
Right 985798662 5:1985918-1985940 CCTGGCCCTGAGCTTCTCTCTGG No data
985798657_985798662 17 Left 985798657 5:1985878-1985900 CCAGCAGATGCTCCAGGTGGACT No data
Right 985798662 5:1985918-1985940 CCTGGCCCTGAGCTTCTCTCTGG No data
985798653_985798662 23 Left 985798653 5:1985872-1985894 CCTAGCCCAGCAGATGCTCCAGG No data
Right 985798662 5:1985918-1985940 CCTGGCCCTGAGCTTCTCTCTGG No data
985798652_985798662 26 Left 985798652 5:1985869-1985891 CCACCTAGCCCAGCAGATGCTCC No data
Right 985798662 5:1985918-1985940 CCTGGCCCTGAGCTTCTCTCTGG No data
985798660_985798662 -10 Left 985798660 5:1985905-1985927 CCATCGATGCTGTCCTGGCCCTG No data
Right 985798662 5:1985918-1985940 CCTGGCCCTGAGCTTCTCTCTGG No data
985798651_985798662 29 Left 985798651 5:1985866-1985888 CCTCCACCTAGCCCAGCAGATGC No data
Right 985798662 5:1985918-1985940 CCTGGCCCTGAGCTTCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985798662 Original CRISPR CCTGGCCCTGAGCTTCTCTC TGG Intergenic
No off target data available for this crispr