ID: 985798666

View in Genome Browser
Species Human (GRCh38)
Location 5:1985926-1985948
Sequence TGAGCTTCTCTCTGGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985798658_985798666 13 Left 985798658 5:1985890-1985912 CCAGGTGGACTTTATCCATCGAT No data
Right 985798666 5:1985926-1985948 TGAGCTTCTCTCTGGGCTGCTGG No data
985798657_985798666 25 Left 985798657 5:1985878-1985900 CCAGCAGATGCTCCAGGTGGACT No data
Right 985798666 5:1985926-1985948 TGAGCTTCTCTCTGGGCTGCTGG No data
985798660_985798666 -2 Left 985798660 5:1985905-1985927 CCATCGATGCTGTCCTGGCCCTG No data
Right 985798666 5:1985926-1985948 TGAGCTTCTCTCTGGGCTGCTGG No data
985798656_985798666 26 Left 985798656 5:1985877-1985899 CCCAGCAGATGCTCCAGGTGGAC No data
Right 985798666 5:1985926-1985948 TGAGCTTCTCTCTGGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985798666 Original CRISPR TGAGCTTCTCTCTGGGCTGC TGG Intergenic
No off target data available for this crispr