ID: 985798667

View in Genome Browser
Species Human (GRCh38)
Location 5:1985927-1985949
Sequence GAGCTTCTCTCTGGGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985798660_985798667 -1 Left 985798660 5:1985905-1985927 CCATCGATGCTGTCCTGGCCCTG No data
Right 985798667 5:1985927-1985949 GAGCTTCTCTCTGGGCTGCTGGG No data
985798658_985798667 14 Left 985798658 5:1985890-1985912 CCAGGTGGACTTTATCCATCGAT No data
Right 985798667 5:1985927-1985949 GAGCTTCTCTCTGGGCTGCTGGG No data
985798657_985798667 26 Left 985798657 5:1985878-1985900 CCAGCAGATGCTCCAGGTGGACT No data
Right 985798667 5:1985927-1985949 GAGCTTCTCTCTGGGCTGCTGGG No data
985798656_985798667 27 Left 985798656 5:1985877-1985899 CCCAGCAGATGCTCCAGGTGGAC No data
Right 985798667 5:1985927-1985949 GAGCTTCTCTCTGGGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985798667 Original CRISPR GAGCTTCTCTCTGGGCTGCT GGG Intergenic
No off target data available for this crispr