ID: 985798668

View in Genome Browser
Species Human (GRCh38)
Location 5:1985931-1985953
Sequence TTCTCTCTGGGCTGCTGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985798657_985798668 30 Left 985798657 5:1985878-1985900 CCAGCAGATGCTCCAGGTGGACT No data
Right 985798668 5:1985931-1985953 TTCTCTCTGGGCTGCTGGGTAGG No data
985798660_985798668 3 Left 985798660 5:1985905-1985927 CCATCGATGCTGTCCTGGCCCTG No data
Right 985798668 5:1985931-1985953 TTCTCTCTGGGCTGCTGGGTAGG No data
985798658_985798668 18 Left 985798658 5:1985890-1985912 CCAGGTGGACTTTATCCATCGAT No data
Right 985798668 5:1985931-1985953 TTCTCTCTGGGCTGCTGGGTAGG No data
985798661_985798668 -10 Left 985798661 5:1985918-1985940 CCTGGCCCTGAGCTTCTCTCTGG No data
Right 985798668 5:1985931-1985953 TTCTCTCTGGGCTGCTGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985798668 Original CRISPR TTCTCTCTGGGCTGCTGGGT AGG Intergenic
No off target data available for this crispr