ID: 985801291

View in Genome Browser
Species Human (GRCh38)
Location 5:2006772-2006794
Sequence TACGCAGGACCGGTGGTGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985801291_985801295 -4 Left 985801291 5:2006772-2006794 CCGGTCACCACCGGTCCTGCGTA No data
Right 985801295 5:2006791-2006813 CGTAACGACATCTCCACATTTGG No data
985801291_985801299 10 Left 985801291 5:2006772-2006794 CCGGTCACCACCGGTCCTGCGTA No data
Right 985801299 5:2006805-2006827 CACATTTGGTGTAGGGAACCAGG No data
985801291_985801297 3 Left 985801291 5:2006772-2006794 CCGGTCACCACCGGTCCTGCGTA No data
Right 985801297 5:2006798-2006820 ACATCTCCACATTTGGTGTAGGG No data
985801291_985801300 24 Left 985801291 5:2006772-2006794 CCGGTCACCACCGGTCCTGCGTA No data
Right 985801300 5:2006819-2006841 GGAACCAGGCTGATGAGCCTCGG No data
985801291_985801296 2 Left 985801291 5:2006772-2006794 CCGGTCACCACCGGTCCTGCGTA No data
Right 985801296 5:2006797-2006819 GACATCTCCACATTTGGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985801291 Original CRISPR TACGCAGGACCGGTGGTGAC CGG (reversed) Intergenic
No off target data available for this crispr