ID: 985802035

View in Genome Browser
Species Human (GRCh38)
Location 5:2010812-2010834
Sequence CATCAGCGGGAGACCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985802035_985802041 -3 Left 985802035 5:2010812-2010834 CCTCCCTGGGTCTCCCGCTGATG No data
Right 985802041 5:2010832-2010854 ATGGCGAGCCCCACAGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985802035 Original CRISPR CATCAGCGGGAGACCCAGGG AGG (reversed) Intergenic
No off target data available for this crispr