ID: 985802293

View in Genome Browser
Species Human (GRCh38)
Location 5:2012608-2012630
Sequence GAAGGGTCTGAAGATGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985802289_985802293 -5 Left 985802289 5:2012590-2012612 CCCTTCTCTGGGGAGATGGAAGG No data
Right 985802293 5:2012608-2012630 GAAGGGTCTGAAGATGCTGCCGG No data
985802282_985802293 21 Left 985802282 5:2012564-2012586 CCATAACAACCAGTGATGACATT No data
Right 985802293 5:2012608-2012630 GAAGGGTCTGAAGATGCTGCCGG No data
985802283_985802293 12 Left 985802283 5:2012573-2012595 CCAGTGATGACATTTTCCCCTTC No data
Right 985802293 5:2012608-2012630 GAAGGGTCTGAAGATGCTGCCGG No data
985802288_985802293 -4 Left 985802288 5:2012589-2012611 CCCCTTCTCTGGGGAGATGGAAG No data
Right 985802293 5:2012608-2012630 GAAGGGTCTGAAGATGCTGCCGG No data
985802291_985802293 -6 Left 985802291 5:2012591-2012613 CCTTCTCTGGGGAGATGGAAGGG No data
Right 985802293 5:2012608-2012630 GAAGGGTCTGAAGATGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985802293 Original CRISPR GAAGGGTCTGAAGATGCTGC CGG Intergenic
No off target data available for this crispr