ID: 985802374

View in Genome Browser
Species Human (GRCh38)
Location 5:2013155-2013177
Sequence GCGCTCACCCCAGGGTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985802374_985802383 26 Left 985802374 5:2013155-2013177 CCCTGTGACCCTGGGGTGAGCGC No data
Right 985802383 5:2013204-2013226 GCAGACGGATGTTCAGACAGAGG No data
985802374_985802379 4 Left 985802374 5:2013155-2013177 CCCTGTGACCCTGGGGTGAGCGC No data
Right 985802379 5:2013182-2013204 GAGACAGTGACCTTTGCCACAGG No data
985802374_985802380 11 Left 985802374 5:2013155-2013177 CCCTGTGACCCTGGGGTGAGCGC No data
Right 985802380 5:2013189-2013211 TGACCTTTGCCACAGGCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985802374 Original CRISPR GCGCTCACCCCAGGGTCACA GGG (reversed) Intergenic
No off target data available for this crispr