ID: 985802487

View in Genome Browser
Species Human (GRCh38)
Location 5:2013844-2013866
Sequence CCGTCCCTGTGGAGTGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985802487_985802496 26 Left 985802487 5:2013844-2013866 CCTCACCCACTCCACAGGGACGG No data
Right 985802496 5:2013893-2013915 ACTTCCGACAGTGAACCCTGAGG No data
985802487_985802497 27 Left 985802487 5:2013844-2013866 CCTCACCCACTCCACAGGGACGG No data
Right 985802497 5:2013894-2013916 CTTCCGACAGTGAACCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985802487 Original CRISPR CCGTCCCTGTGGAGTGGGTG AGG (reversed) Intergenic
No off target data available for this crispr