ID: 985802490

View in Genome Browser
Species Human (GRCh38)
Location 5:2013849-2013871
Sequence GTCTCCCGTCCCTGTGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985802490_985802497 22 Left 985802490 5:2013849-2013871 CCCACTCCACAGGGACGGGAGAC No data
Right 985802497 5:2013894-2013916 CTTCCGACAGTGAACCCTGAGGG No data
985802490_985802496 21 Left 985802490 5:2013849-2013871 CCCACTCCACAGGGACGGGAGAC No data
Right 985802496 5:2013893-2013915 ACTTCCGACAGTGAACCCTGAGG No data
985802490_985802500 27 Left 985802490 5:2013849-2013871 CCCACTCCACAGGGACGGGAGAC No data
Right 985802500 5:2013899-2013921 GACAGTGAACCCTGAGGGAAGGG No data
985802490_985802499 26 Left 985802490 5:2013849-2013871 CCCACTCCACAGGGACGGGAGAC No data
Right 985802499 5:2013898-2013920 CGACAGTGAACCCTGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985802490 Original CRISPR GTCTCCCGTCCCTGTGGAGT GGG (reversed) Intergenic
No off target data available for this crispr