ID: 985802491

View in Genome Browser
Species Human (GRCh38)
Location 5:2013850-2013872
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985802491_985802496 20 Left 985802491 5:2013850-2013872 CCACTCCACAGGGACGGGAGACG No data
Right 985802496 5:2013893-2013915 ACTTCCGACAGTGAACCCTGAGG No data
985802491_985802499 25 Left 985802491 5:2013850-2013872 CCACTCCACAGGGACGGGAGACG No data
Right 985802499 5:2013898-2013920 CGACAGTGAACCCTGAGGGAAGG No data
985802491_985802500 26 Left 985802491 5:2013850-2013872 CCACTCCACAGGGACGGGAGACG No data
Right 985802500 5:2013899-2013921 GACAGTGAACCCTGAGGGAAGGG No data
985802491_985802497 21 Left 985802491 5:2013850-2013872 CCACTCCACAGGGACGGGAGACG No data
Right 985802497 5:2013894-2013916 CTTCCGACAGTGAACCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985802491 Original CRISPR CGTCTCCCGTCCCTGTGGAG TGG (reversed) Intergenic
No off target data available for this crispr