ID: 985802493

View in Genome Browser
Species Human (GRCh38)
Location 5:2013855-2013877
Sequence TTTGCCGTCTCCCGTCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985802493_985802501 27 Left 985802493 5:2013855-2013877 CCACAGGGACGGGAGACGGCAAA No data
Right 985802501 5:2013905-2013927 GAACCCTGAGGGAAGGGTCATGG No data
985802493_985802497 16 Left 985802493 5:2013855-2013877 CCACAGGGACGGGAGACGGCAAA No data
Right 985802497 5:2013894-2013916 CTTCCGACAGTGAACCCTGAGGG No data
985802493_985802496 15 Left 985802493 5:2013855-2013877 CCACAGGGACGGGAGACGGCAAA No data
Right 985802496 5:2013893-2013915 ACTTCCGACAGTGAACCCTGAGG No data
985802493_985802499 20 Left 985802493 5:2013855-2013877 CCACAGGGACGGGAGACGGCAAA No data
Right 985802499 5:2013898-2013920 CGACAGTGAACCCTGAGGGAAGG No data
985802493_985802500 21 Left 985802493 5:2013855-2013877 CCACAGGGACGGGAGACGGCAAA No data
Right 985802500 5:2013899-2013921 GACAGTGAACCCTGAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985802493 Original CRISPR TTTGCCGTCTCCCGTCCCTG TGG (reversed) Intergenic
No off target data available for this crispr