ID: 985802495

View in Genome Browser
Species Human (GRCh38)
Location 5:2013891-2013913
Sequence TCAGGGTTCACTGTCGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985802495_985802501 -9 Left 985802495 5:2013891-2013913 CCACTTCCGACAGTGAACCCTGA No data
Right 985802501 5:2013905-2013927 GAACCCTGAGGGAAGGGTCATGG No data
985802495_985802504 10 Left 985802495 5:2013891-2013913 CCACTTCCGACAGTGAACCCTGA No data
Right 985802504 5:2013924-2013946 ATGGAAACGTACAGATGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985802495 Original CRISPR TCAGGGTTCACTGTCGGAAG TGG (reversed) Intergenic
No off target data available for this crispr