ID: 985802496

View in Genome Browser
Species Human (GRCh38)
Location 5:2013893-2013915
Sequence ACTTCCGACAGTGAACCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985802487_985802496 26 Left 985802487 5:2013844-2013866 CCTCACCCACTCCACAGGGACGG No data
Right 985802496 5:2013893-2013915 ACTTCCGACAGTGAACCCTGAGG No data
985802493_985802496 15 Left 985802493 5:2013855-2013877 CCACAGGGACGGGAGACGGCAAA No data
Right 985802496 5:2013893-2013915 ACTTCCGACAGTGAACCCTGAGG No data
985802491_985802496 20 Left 985802491 5:2013850-2013872 CCACTCCACAGGGACGGGAGACG No data
Right 985802496 5:2013893-2013915 ACTTCCGACAGTGAACCCTGAGG No data
985802490_985802496 21 Left 985802490 5:2013849-2013871 CCCACTCCACAGGGACGGGAGAC No data
Right 985802496 5:2013893-2013915 ACTTCCGACAGTGAACCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985802496 Original CRISPR ACTTCCGACAGTGAACCCTG AGG Intergenic
No off target data available for this crispr