ID: 985802501

View in Genome Browser
Species Human (GRCh38)
Location 5:2013905-2013927
Sequence GAACCCTGAGGGAAGGGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985802493_985802501 27 Left 985802493 5:2013855-2013877 CCACAGGGACGGGAGACGGCAAA No data
Right 985802501 5:2013905-2013927 GAACCCTGAGGGAAGGGTCATGG No data
985802495_985802501 -9 Left 985802495 5:2013891-2013913 CCACTTCCGACAGTGAACCCTGA No data
Right 985802501 5:2013905-2013927 GAACCCTGAGGGAAGGGTCATGG No data
985802494_985802501 -8 Left 985802494 5:2013890-2013912 CCCACTTCCGACAGTGAACCCTG No data
Right 985802501 5:2013905-2013927 GAACCCTGAGGGAAGGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985802501 Original CRISPR GAACCCTGAGGGAAGGGTCA TGG Intergenic
No off target data available for this crispr