ID: 985802540

View in Genome Browser
Species Human (GRCh38)
Location 5:2014288-2014310
Sequence CCATGCACTTAAGGTCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985802540_985802544 -10 Left 985802540 5:2014288-2014310 CCCAGCTGACCTTAAGTGCATGG No data
Right 985802544 5:2014301-2014323 AAGTGCATGGATCAGTGAAGCGG No data
985802540_985802550 25 Left 985802540 5:2014288-2014310 CCCAGCTGACCTTAAGTGCATGG No data
Right 985802550 5:2014336-2014358 AGCTGGGCAGTCCTCAGGACTGG No data
985802540_985802548 20 Left 985802540 5:2014288-2014310 CCCAGCTGACCTTAAGTGCATGG No data
Right 985802548 5:2014331-2014353 AGTCCAGCTGGGCAGTCCTCAGG No data
985802540_985802545 -7 Left 985802540 5:2014288-2014310 CCCAGCTGACCTTAAGTGCATGG No data
Right 985802545 5:2014304-2014326 TGCATGGATCAGTGAAGCGGTGG No data
985802540_985802547 9 Left 985802540 5:2014288-2014310 CCCAGCTGACCTTAAGTGCATGG No data
Right 985802547 5:2014320-2014342 GCGGTGGCAAGAGTCCAGCTGGG No data
985802540_985802546 8 Left 985802540 5:2014288-2014310 CCCAGCTGACCTTAAGTGCATGG No data
Right 985802546 5:2014319-2014341 AGCGGTGGCAAGAGTCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985802540 Original CRISPR CCATGCACTTAAGGTCAGCT GGG (reversed) Intergenic
No off target data available for this crispr