ID: 985803584

View in Genome Browser
Species Human (GRCh38)
Location 5:2021999-2022021
Sequence CTGTGTTAGGGGGAGGCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985803584_985803592 8 Left 985803584 5:2021999-2022021 CCCCTTGCCTCCCCCTAACACAG No data
Right 985803592 5:2022030-2022052 TCATATGCTTAAGTAAAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985803584 Original CRISPR CTGTGTTAGGGGGAGGCAAG GGG (reversed) Intergenic
No off target data available for this crispr