ID: 985806261

View in Genome Browser
Species Human (GRCh38)
Location 5:2045725-2045747
Sequence TACTCTGAAGAATCTCTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985806261_985806268 29 Left 985806261 5:2045725-2045747 CCTACAAGAGATTCTTCAGAGTA No data
Right 985806268 5:2045777-2045799 CTTTGTCCCAGGGTATTTGTTGG No data
985806261_985806267 19 Left 985806261 5:2045725-2045747 CCTACAAGAGATTCTTCAGAGTA No data
Right 985806267 5:2045767-2045789 GCACTTACTTCTTTGTCCCAGGG No data
985806261_985806266 18 Left 985806261 5:2045725-2045747 CCTACAAGAGATTCTTCAGAGTA No data
Right 985806266 5:2045766-2045788 GGCACTTACTTCTTTGTCCCAGG No data
985806261_985806269 30 Left 985806261 5:2045725-2045747 CCTACAAGAGATTCTTCAGAGTA No data
Right 985806269 5:2045778-2045800 TTTGTCCCAGGGTATTTGTTGGG No data
985806261_985806262 -3 Left 985806261 5:2045725-2045747 CCTACAAGAGATTCTTCAGAGTA No data
Right 985806262 5:2045745-2045767 GTACCTCCCATGCAAACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985806261 Original CRISPR TACTCTGAAGAATCTCTTGT AGG (reversed) Intergenic
No off target data available for this crispr