ID: 985806264

View in Genome Browser
Species Human (GRCh38)
Location 5:2045751-2045773
Sequence TAAGTGCCAGCAGTTTGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985806264_985806269 4 Left 985806264 5:2045751-2045773 CCCATGCAAACTGCTGGCACTTA No data
Right 985806269 5:2045778-2045800 TTTGTCCCAGGGTATTTGTTGGG No data
985806264_985806268 3 Left 985806264 5:2045751-2045773 CCCATGCAAACTGCTGGCACTTA No data
Right 985806268 5:2045777-2045799 CTTTGTCCCAGGGTATTTGTTGG No data
985806264_985806266 -8 Left 985806264 5:2045751-2045773 CCCATGCAAACTGCTGGCACTTA No data
Right 985806266 5:2045766-2045788 GGCACTTACTTCTTTGTCCCAGG No data
985806264_985806267 -7 Left 985806264 5:2045751-2045773 CCCATGCAAACTGCTGGCACTTA No data
Right 985806267 5:2045767-2045789 GCACTTACTTCTTTGTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985806264 Original CRISPR TAAGTGCCAGCAGTTTGCAT GGG (reversed) Intergenic
No off target data available for this crispr