ID: 985806269

View in Genome Browser
Species Human (GRCh38)
Location 5:2045778-2045800
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985806264_985806269 4 Left 985806264 5:2045751-2045773 CCCATGCAAACTGCTGGCACTTA No data
Right 985806269 5:2045778-2045800 TTTGTCCCAGGGTATTTGTTGGG No data
985806261_985806269 30 Left 985806261 5:2045725-2045747 CCTACAAGAGATTCTTCAGAGTA No data
Right 985806269 5:2045778-2045800 TTTGTCCCAGGGTATTTGTTGGG No data
985806263_985806269 7 Left 985806263 5:2045748-2045770 CCTCCCATGCAAACTGCTGGCAC No data
Right 985806269 5:2045778-2045800 TTTGTCCCAGGGTATTTGTTGGG No data
985806265_985806269 3 Left 985806265 5:2045752-2045774 CCATGCAAACTGCTGGCACTTAC No data
Right 985806269 5:2045778-2045800 TTTGTCCCAGGGTATTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr