ID: 985807866

View in Genome Browser
Species Human (GRCh38)
Location 5:2060379-2060401
Sequence TGTTCCTGAACACCAGACAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985807862_985807866 10 Left 985807862 5:2060346-2060368 CCTGTGAATGCGAGCTTCCTACT No data
Right 985807866 5:2060379-2060401 TGTTCCTGAACACCAGACAGCGG No data
985807865_985807866 -7 Left 985807865 5:2060363-2060385 CCTACTTGGGAGCTGATGTTCCT No data
Right 985807866 5:2060379-2060401 TGTTCCTGAACACCAGACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985807866 Original CRISPR TGTTCCTGAACACCAGACAG CGG Intergenic