ID: 985810234

View in Genome Browser
Species Human (GRCh38)
Location 5:2077946-2077968
Sequence ATGCTGTGATTGATGAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985810227_985810234 27 Left 985810227 5:2077896-2077918 CCTTCCATTCAGATAGGATGCAG No data
Right 985810234 5:2077946-2077968 ATGCTGTGATTGATGAAATTTGG No data
985810228_985810234 23 Left 985810228 5:2077900-2077922 CCATTCAGATAGGATGCAGATCA No data
Right 985810234 5:2077946-2077968 ATGCTGTGATTGATGAAATTTGG No data
985810225_985810234 29 Left 985810225 5:2077894-2077916 CCCCTTCCATTCAGATAGGATGC No data
Right 985810234 5:2077946-2077968 ATGCTGTGATTGATGAAATTTGG No data
985810226_985810234 28 Left 985810226 5:2077895-2077917 CCCTTCCATTCAGATAGGATGCA No data
Right 985810234 5:2077946-2077968 ATGCTGTGATTGATGAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985810234 Original CRISPR ATGCTGTGATTGATGAAATT TGG Intergenic
No off target data available for this crispr