ID: 985810291

View in Genome Browser
Species Human (GRCh38)
Location 5:2078205-2078227
Sequence GAGGCAGCCTAGGCCCTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985810291_985810297 -3 Left 985810291 5:2078205-2078227 CCGTGCAGGGCCTAGGCTGCCTC No data
Right 985810297 5:2078225-2078247 CTCCAGGGTCCGGCCACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985810291 Original CRISPR GAGGCAGCCTAGGCCCTGCA CGG (reversed) Intergenic
No off target data available for this crispr