ID: 985810297

View in Genome Browser
Species Human (GRCh38)
Location 5:2078225-2078247
Sequence CTCCAGGGTCCGGCCACCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985810282_985810297 25 Left 985810282 5:2078177-2078199 CCTTGACCTCTGAGAGTGCCCTG No data
Right 985810297 5:2078225-2078247 CTCCAGGGTCCGGCCACCCCCGG No data
985810285_985810297 19 Left 985810285 5:2078183-2078205 CCTCTGAGAGTGCCCTGGGCTGC No data
Right 985810297 5:2078225-2078247 CTCCAGGGTCCGGCCACCCCCGG No data
985810288_985810297 7 Left 985810288 5:2078195-2078217 CCCTGGGCTGCCGTGCAGGGCCT No data
Right 985810297 5:2078225-2078247 CTCCAGGGTCCGGCCACCCCCGG No data
985810289_985810297 6 Left 985810289 5:2078196-2078218 CCTGGGCTGCCGTGCAGGGCCTA No data
Right 985810297 5:2078225-2078247 CTCCAGGGTCCGGCCACCCCCGG No data
985810291_985810297 -3 Left 985810291 5:2078205-2078227 CCGTGCAGGGCCTAGGCTGCCTC No data
Right 985810297 5:2078225-2078247 CTCCAGGGTCCGGCCACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985810297 Original CRISPR CTCCAGGGTCCGGCCACCCC CGG Intergenic
No off target data available for this crispr