ID: 985811941

View in Genome Browser
Species Human (GRCh38)
Location 5:2096769-2096791
Sequence TTGGATGTTTACCTGAAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985811941_985811950 25 Left 985811941 5:2096769-2096791 CCGCCCTTCAGGTAAACATCCAA No data
Right 985811950 5:2096817-2096839 GCGCCTCCCACAGCCCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985811941 Original CRISPR TTGGATGTTTACCTGAAGGG CGG (reversed) Intergenic
No off target data available for this crispr