ID: 985811942

View in Genome Browser
Species Human (GRCh38)
Location 5:2096772-2096794
Sequence GTTTTGGATGTTTACCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985811942_985811954 29 Left 985811942 5:2096772-2096794 CCCTTCAGGTAAACATCCAAAAC No data
Right 985811954 5:2096824-2096846 CCACAGCCCCCAGAGGAGAGAGG No data
985811942_985811950 22 Left 985811942 5:2096772-2096794 CCCTTCAGGTAAACATCCAAAAC No data
Right 985811950 5:2096817-2096839 GCGCCTCCCACAGCCCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985811942 Original CRISPR GTTTTGGATGTTTACCTGAA GGG (reversed) Intergenic
No off target data available for this crispr