ID: 985811943

View in Genome Browser
Species Human (GRCh38)
Location 5:2096773-2096795
Sequence GGTTTTGGATGTTTACCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985811943_985811950 21 Left 985811943 5:2096773-2096795 CCTTCAGGTAAACATCCAAAACC No data
Right 985811950 5:2096817-2096839 GCGCCTCCCACAGCCCCCAGAGG No data
985811943_985811954 28 Left 985811943 5:2096773-2096795 CCTTCAGGTAAACATCCAAAACC No data
Right 985811954 5:2096824-2096846 CCACAGCCCCCAGAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985811943 Original CRISPR GGTTTTGGATGTTTACCTGA AGG (reversed) Intergenic
No off target data available for this crispr