ID: 985811944

View in Genome Browser
Species Human (GRCh38)
Location 5:2096788-2096810
Sequence ACGGGGTCACAGGAAGGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985811944_985811950 6 Left 985811944 5:2096788-2096810 CCAAAACCTTCCTGTGACCCCGT No data
Right 985811950 5:2096817-2096839 GCGCCTCCCACAGCCCCCAGAGG No data
985811944_985811959 22 Left 985811944 5:2096788-2096810 CCAAAACCTTCCTGTGACCCCGT No data
Right 985811959 5:2096833-2096855 CCAGAGGAGAGAGGTAACCTCGG No data
985811944_985811954 13 Left 985811944 5:2096788-2096810 CCAAAACCTTCCTGTGACCCCGT No data
Right 985811954 5:2096824-2096846 CCACAGCCCCCAGAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985811944 Original CRISPR ACGGGGTCACAGGAAGGTTT TGG (reversed) Intergenic
No off target data available for this crispr