ID: 985811945

View in Genome Browser
Species Human (GRCh38)
Location 5:2096794-2096816
Sequence TTCTGCACGGGGTCACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985811945_985811954 7 Left 985811945 5:2096794-2096816 CCTTCCTGTGACCCCGTGCAGAA No data
Right 985811954 5:2096824-2096846 CCACAGCCCCCAGAGGAGAGAGG No data
985811945_985811959 16 Left 985811945 5:2096794-2096816 CCTTCCTGTGACCCCGTGCAGAA No data
Right 985811959 5:2096833-2096855 CCAGAGGAGAGAGGTAACCTCGG No data
985811945_985811950 0 Left 985811945 5:2096794-2096816 CCTTCCTGTGACCCCGTGCAGAA No data
Right 985811950 5:2096817-2096839 GCGCCTCCCACAGCCCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985811945 Original CRISPR TTCTGCACGGGGTCACAGGA AGG (reversed) Intergenic
No off target data available for this crispr