ID: 985811946

View in Genome Browser
Species Human (GRCh38)
Location 5:2096798-2096820
Sequence GCGCTTCTGCACGGGGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985811946_985811954 3 Left 985811946 5:2096798-2096820 CCTGTGACCCCGTGCAGAAGCGC No data
Right 985811954 5:2096824-2096846 CCACAGCCCCCAGAGGAGAGAGG No data
985811946_985811962 30 Left 985811946 5:2096798-2096820 CCTGTGACCCCGTGCAGAAGCGC No data
Right 985811962 5:2096851-2096873 CTCGGCAGATGCTGAGACCAGGG No data
985811946_985811961 29 Left 985811946 5:2096798-2096820 CCTGTGACCCCGTGCAGAAGCGC No data
Right 985811961 5:2096850-2096872 CCTCGGCAGATGCTGAGACCAGG No data
985811946_985811950 -4 Left 985811946 5:2096798-2096820 CCTGTGACCCCGTGCAGAAGCGC No data
Right 985811950 5:2096817-2096839 GCGCCTCCCACAGCCCCCAGAGG No data
985811946_985811959 12 Left 985811946 5:2096798-2096820 CCTGTGACCCCGTGCAGAAGCGC No data
Right 985811959 5:2096833-2096855 CCAGAGGAGAGAGGTAACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985811946 Original CRISPR GCGCTTCTGCACGGGGTCAC AGG (reversed) Intergenic
No off target data available for this crispr