ID: 985811950

View in Genome Browser
Species Human (GRCh38)
Location 5:2096817-2096839
Sequence GCGCCTCCCACAGCCCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985811941_985811950 25 Left 985811941 5:2096769-2096791 CCGCCCTTCAGGTAAACATCCAA No data
Right 985811950 5:2096817-2096839 GCGCCTCCCACAGCCCCCAGAGG No data
985811945_985811950 0 Left 985811945 5:2096794-2096816 CCTTCCTGTGACCCCGTGCAGAA No data
Right 985811950 5:2096817-2096839 GCGCCTCCCACAGCCCCCAGAGG No data
985811946_985811950 -4 Left 985811946 5:2096798-2096820 CCTGTGACCCCGTGCAGAAGCGC No data
Right 985811950 5:2096817-2096839 GCGCCTCCCACAGCCCCCAGAGG No data
985811942_985811950 22 Left 985811942 5:2096772-2096794 CCCTTCAGGTAAACATCCAAAAC No data
Right 985811950 5:2096817-2096839 GCGCCTCCCACAGCCCCCAGAGG No data
985811943_985811950 21 Left 985811943 5:2096773-2096795 CCTTCAGGTAAACATCCAAAACC No data
Right 985811950 5:2096817-2096839 GCGCCTCCCACAGCCCCCAGAGG No data
985811944_985811950 6 Left 985811944 5:2096788-2096810 CCAAAACCTTCCTGTGACCCCGT No data
Right 985811950 5:2096817-2096839 GCGCCTCCCACAGCCCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985811950 Original CRISPR GCGCCTCCCACAGCCCCCAG AGG Intergenic
No off target data available for this crispr