ID: 985811954

View in Genome Browser
Species Human (GRCh38)
Location 5:2096824-2096846
Sequence CCACAGCCCCCAGAGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985811947_985811954 -4 Left 985811947 5:2096805-2096827 CCCCGTGCAGAAGCGCCTCCCAC No data
Right 985811954 5:2096824-2096846 CCACAGCCCCCAGAGGAGAGAGG No data
985811948_985811954 -5 Left 985811948 5:2096806-2096828 CCCGTGCAGAAGCGCCTCCCACA No data
Right 985811954 5:2096824-2096846 CCACAGCCCCCAGAGGAGAGAGG No data
985811943_985811954 28 Left 985811943 5:2096773-2096795 CCTTCAGGTAAACATCCAAAACC No data
Right 985811954 5:2096824-2096846 CCACAGCCCCCAGAGGAGAGAGG No data
985811946_985811954 3 Left 985811946 5:2096798-2096820 CCTGTGACCCCGTGCAGAAGCGC No data
Right 985811954 5:2096824-2096846 CCACAGCCCCCAGAGGAGAGAGG No data
985811942_985811954 29 Left 985811942 5:2096772-2096794 CCCTTCAGGTAAACATCCAAAAC No data
Right 985811954 5:2096824-2096846 CCACAGCCCCCAGAGGAGAGAGG No data
985811945_985811954 7 Left 985811945 5:2096794-2096816 CCTTCCTGTGACCCCGTGCAGAA No data
Right 985811954 5:2096824-2096846 CCACAGCCCCCAGAGGAGAGAGG No data
985811949_985811954 -6 Left 985811949 5:2096807-2096829 CCGTGCAGAAGCGCCTCCCACAG No data
Right 985811954 5:2096824-2096846 CCACAGCCCCCAGAGGAGAGAGG No data
985811944_985811954 13 Left 985811944 5:2096788-2096810 CCAAAACCTTCCTGTGACCCCGT No data
Right 985811954 5:2096824-2096846 CCACAGCCCCCAGAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985811954 Original CRISPR CCACAGCCCCCAGAGGAGAG AGG Intergenic
No off target data available for this crispr