ID: 985812768

View in Genome Browser
Species Human (GRCh38)
Location 5:2102346-2102368
Sequence CTGTGAAAGGCCAAGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985812768_985812776 11 Left 985812768 5:2102346-2102368 CCAGCCACCTTGGCCTTTCACAG No data
Right 985812776 5:2102380-2102402 CAGGGCTGAGCCTCTGTGCCCGG No data
985812768_985812778 25 Left 985812768 5:2102346-2102368 CCAGCCACCTTGGCCTTTCACAG No data
Right 985812778 5:2102394-2102416 TGTGCCCGGCCAGACTAAGCAGG No data
985812768_985812775 -7 Left 985812768 5:2102346-2102368 CCAGCCACCTTGGCCTTTCACAG No data
Right 985812775 5:2102362-2102384 TTCACAGTGCTGGGATTACAGGG No data
985812768_985812774 -8 Left 985812768 5:2102346-2102368 CCAGCCACCTTGGCCTTTCACAG No data
Right 985812774 5:2102361-2102383 TTTCACAGTGCTGGGATTACAGG 0: 11
1: 841
2: 25493
3: 326815
4: 260072

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985812768 Original CRISPR CTGTGAAAGGCCAAGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr