ID: 985814246

View in Genome Browser
Species Human (GRCh38)
Location 5:2114844-2114866
Sequence AATGATCTGCAGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985814246_985814250 -2 Left 985814246 5:2114844-2114866 CCTGCCTCCCTCTGCAGATCATT No data
Right 985814250 5:2114865-2114887 TTTCCAGCAAGTTCTCCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985814246 Original CRISPR AATGATCTGCAGAGGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr