ID: 985814246 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:2114844-2114866 |
| Sequence | AATGATCTGCAGAGGGAGGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 985814246_985814250 | -2 | Left | 985814246 | 5:2114844-2114866 | CCTGCCTCCCTCTGCAGATCATT | No data | ||
| Right | 985814250 | 5:2114865-2114887 | TTTCCAGCAAGTTCTCCTGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 985814246 | Original CRISPR | AATGATCTGCAGAGGGAGGC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||