ID: 985815319

View in Genome Browser
Species Human (GRCh38)
Location 5:2124121-2124143
Sequence TGGGGGTCCCAGGGCTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985815302_985815319 13 Left 985815302 5:2124085-2124107 CCCCAGGTGCCCCCAGCTGTCCC No data
Right 985815319 5:2124121-2124143 TGGGGGTCCCAGGGCTCACAGGG No data
985815303_985815319 12 Left 985815303 5:2124086-2124108 CCCAGGTGCCCCCAGCTGTCCCA No data
Right 985815319 5:2124121-2124143 TGGGGGTCCCAGGGCTCACAGGG No data
985815304_985815319 11 Left 985815304 5:2124087-2124109 CCAGGTGCCCCCAGCTGTCCCAG No data
Right 985815319 5:2124121-2124143 TGGGGGTCCCAGGGCTCACAGGG No data
985815307_985815319 2 Left 985815307 5:2124096-2124118 CCCAGCTGTCCCAGTGTCTCTGG No data
Right 985815319 5:2124121-2124143 TGGGGGTCCCAGGGCTCACAGGG No data
985815305_985815319 4 Left 985815305 5:2124094-2124116 CCCCCAGCTGTCCCAGTGTCTCT No data
Right 985815319 5:2124121-2124143 TGGGGGTCCCAGGGCTCACAGGG No data
985815315_985815319 -8 Left 985815315 5:2124106-2124128 CCAGTGTCTCTGGCATGGGGGTC No data
Right 985815319 5:2124121-2124143 TGGGGGTCCCAGGGCTCACAGGG No data
985815309_985815319 1 Left 985815309 5:2124097-2124119 CCAGCTGTCCCAGTGTCTCTGGC No data
Right 985815319 5:2124121-2124143 TGGGGGTCCCAGGGCTCACAGGG No data
985815314_985815319 -7 Left 985815314 5:2124105-2124127 CCCAGTGTCTCTGGCATGGGGGT No data
Right 985815319 5:2124121-2124143 TGGGGGTCCCAGGGCTCACAGGG No data
985815306_985815319 3 Left 985815306 5:2124095-2124117 CCCCAGCTGTCCCAGTGTCTCTG No data
Right 985815319 5:2124121-2124143 TGGGGGTCCCAGGGCTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985815319 Original CRISPR TGGGGGTCCCAGGGCTCACA GGG Intergenic
No off target data available for this crispr