ID: 985817247

View in Genome Browser
Species Human (GRCh38)
Location 5:2135976-2135998
Sequence CTCCAACGGCTGTCAGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985817247_985817256 30 Left 985817247 5:2135976-2135998 CCTGAGCCTGACAGCCGTTGGAG No data
Right 985817256 5:2136029-2136051 CTCCTCTTCCCCTGCATCTCTGG No data
985817247_985817253 -1 Left 985817247 5:2135976-2135998 CCTGAGCCTGACAGCCGTTGGAG No data
Right 985817253 5:2135998-2136020 GGGGCAGTCTGTGCCCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985817247 Original CRISPR CTCCAACGGCTGTCAGGCTC AGG (reversed) Intergenic
No off target data available for this crispr