ID: 985819869

View in Genome Browser
Species Human (GRCh38)
Location 5:2152331-2152353
Sequence CTCATTGCACAGATGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985819858_985819869 30 Left 985819858 5:2152278-2152300 CCCATCTCACAGAGTGGTGTCGA No data
Right 985819869 5:2152331-2152353 CTCATTGCACAGATGGAAGATGG No data
985819859_985819869 29 Left 985819859 5:2152279-2152301 CCATCTCACAGAGTGGTGTCGAG No data
Right 985819869 5:2152331-2152353 CTCATTGCACAGATGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985819869 Original CRISPR CTCATTGCACAGATGGAAGA TGG Intergenic
No off target data available for this crispr