ID: 985819872

View in Genome Browser
Species Human (GRCh38)
Location 5:2152366-2152388
Sequence CTCATTGCACAGATGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985819867_985819872 23 Left 985819867 5:2152320-2152342 CCATTTACACTCTCATTGCACAG No data
Right 985819872 5:2152366-2152388 CTCATTGCACAGATGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985819872 Original CRISPR CTCATTGCACAGATGGAAGA TGG Intergenic
No off target data available for this crispr