ID: 985819875

View in Genome Browser
Species Human (GRCh38)
Location 5:2152401-2152423
Sequence CTCATTGCACAGATGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985819870_985819875 23 Left 985819870 5:2152355-2152377 CCATTTACACTCTCATTGCACAG No data
Right 985819875 5:2152401-2152423 CTCATTGCACAGATGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985819875 Original CRISPR CTCATTGCACAGATGGAAGA TGG Intergenic
No off target data available for this crispr