ID: 985819875 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:2152401-2152423 |
| Sequence | CTCATTGCACAGATGGAAGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 985819870_985819875 | 23 | Left | 985819870 | 5:2152355-2152377 | CCATTTACACTCTCATTGCACAG | No data | ||
| Right | 985819875 | 5:2152401-2152423 | CTCATTGCACAGATGGAAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 985819875 | Original CRISPR | CTCATTGCACAGATGGAAGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||