ID: 985819878

View in Genome Browser
Species Human (GRCh38)
Location 5:2152436-2152458
Sequence CTCACTGCACAGATGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985819873_985819878 23 Left 985819873 5:2152390-2152412 CCATTTACACTCTCATTGCACAG No data
Right 985819878 5:2152436-2152458 CTCACTGCACAGATGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985819878 Original CRISPR CTCACTGCACAGATGGAAGA TGG Intergenic
No off target data available for this crispr