ID: 985820046

View in Genome Browser
Species Human (GRCh38)
Location 5:2153495-2153517
Sequence CCAGCCCTACTGATTTCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985820046_985820051 -10 Left 985820046 5:2153495-2153517 CCCGGGGAAATCAGTAGGGCTGG No data
Right 985820051 5:2153508-2153530 GTAGGGCTGGCGGGCCTTCTAGG No data
985820046_985820052 -1 Left 985820046 5:2153495-2153517 CCCGGGGAAATCAGTAGGGCTGG No data
Right 985820052 5:2153517-2153539 GCGGGCCTTCTAGGTCCACCTGG No data
985820046_985820057 17 Left 985820046 5:2153495-2153517 CCCGGGGAAATCAGTAGGGCTGG No data
Right 985820057 5:2153535-2153557 CCTGGAACCTCGACTGTGGCAGG No data
985820046_985820054 13 Left 985820046 5:2153495-2153517 CCCGGGGAAATCAGTAGGGCTGG No data
Right 985820054 5:2153531-2153553 TCCACCTGGAACCTCGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985820046 Original CRISPR CCAGCCCTACTGATTTCCCC GGG (reversed) Intergenic
No off target data available for this crispr