ID: 985821958

View in Genome Browser
Species Human (GRCh38)
Location 5:2166546-2166568
Sequence TGACTGTGGTGGGAGTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985821949_985821958 17 Left 985821949 5:2166506-2166528 CCTGAGAACACTGATTCTGCTCA No data
Right 985821958 5:2166546-2166568 TGACTGTGGTGGGAGTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985821958 Original CRISPR TGACTGTGGTGGGAGTGTGG GGG Intergenic
No off target data available for this crispr