ID: 985824088

View in Genome Browser
Species Human (GRCh38)
Location 5:2180159-2180181
Sequence ACACCTCGGGGGCGAGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985824077_985824088 10 Left 985824077 5:2180126-2180148 CCCAGGAGGAAGCGTGAACATAC No data
Right 985824088 5:2180159-2180181 ACACCTCGGGGGCGAGAGGGTGG No data
985824078_985824088 9 Left 985824078 5:2180127-2180149 CCAGGAGGAAGCGTGAACATACC No data
Right 985824088 5:2180159-2180181 ACACCTCGGGGGCGAGAGGGTGG No data
985824074_985824088 29 Left 985824074 5:2180107-2180129 CCAAGTTCAGTTCTCAGCACCCA No data
Right 985824088 5:2180159-2180181 ACACCTCGGGGGCGAGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985824088 Original CRISPR ACACCTCGGGGGCGAGAGGG TGG Intergenic
No off target data available for this crispr