ID: 985825846

View in Genome Browser
Species Human (GRCh38)
Location 5:2191004-2191026
Sequence TAGAGTGAGTTGGGCACCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985825846_985825849 -8 Left 985825846 5:2191004-2191026 CCGGAGGTGCCCAACTCACTCTA No data
Right 985825849 5:2191019-2191041 TCACTCTATGCAAAAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985825846 Original CRISPR TAGAGTGAGTTGGGCACCTC CGG (reversed) Intergenic
No off target data available for this crispr