ID: 985826276

View in Genome Browser
Species Human (GRCh38)
Location 5:2193944-2193966
Sequence CCTAATATGGAAAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985826276_985826284 0 Left 985826276 5:2193944-2193966 CCAGCCTCCCTTTCCATATTAGG No data
Right 985826284 5:2193967-2193989 AGGCAGAAGGACCTGCTGCCAGG No data
985826276_985826291 28 Left 985826276 5:2193944-2193966 CCAGCCTCCCTTTCCATATTAGG No data
Right 985826291 5:2193995-2194017 AGGCACAGCACACATGACAGGGG No data
985826276_985826290 27 Left 985826276 5:2193944-2193966 CCAGCCTCCCTTTCCATATTAGG No data
Right 985826290 5:2193994-2194016 AAGGCACAGCACACATGACAGGG No data
985826276_985826285 8 Left 985826276 5:2193944-2193966 CCAGCCTCCCTTTCCATATTAGG No data
Right 985826285 5:2193975-2193997 GGACCTGCTGCCAGGCCACAAGG No data
985826276_985826289 26 Left 985826276 5:2193944-2193966 CCAGCCTCCCTTTCCATATTAGG No data
Right 985826289 5:2193993-2194015 CAAGGCACAGCACACATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985826276 Original CRISPR CCTAATATGGAAAGGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr