ID: 985826417

View in Genome Browser
Species Human (GRCh38)
Location 5:2195043-2195065
Sequence GACAGGGATGGTCCTACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985826417_985826428 9 Left 985826417 5:2195043-2195065 CCATGTGTAGGACCATCCCTGTC No data
Right 985826428 5:2195075-2195097 CAACATGTGGCCTGGGTTCTTGG No data
985826417_985826421 -4 Left 985826417 5:2195043-2195065 CCATGTGTAGGACCATCCCTGTC No data
Right 985826421 5:2195062-2195084 TGTCCAACCCTTCCAACATGTGG No data
985826417_985826424 2 Left 985826417 5:2195043-2195065 CCATGTGTAGGACCATCCCTGTC No data
Right 985826424 5:2195068-2195090 ACCCTTCCAACATGTGGCCTGGG No data
985826417_985826423 1 Left 985826417 5:2195043-2195065 CCATGTGTAGGACCATCCCTGTC No data
Right 985826423 5:2195067-2195089 AACCCTTCCAACATGTGGCCTGG No data
985826417_985826431 30 Left 985826417 5:2195043-2195065 CCATGTGTAGGACCATCCCTGTC No data
Right 985826431 5:2195096-2195118 GGTGCTGGTGCCCTCCCAACAGG No data
985826417_985826429 15 Left 985826417 5:2195043-2195065 CCATGTGTAGGACCATCCCTGTC No data
Right 985826429 5:2195081-2195103 GTGGCCTGGGTTCTTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985826417 Original CRISPR GACAGGGATGGTCCTACACA TGG (reversed) Intergenic
No off target data available for this crispr