ID: 985827038

View in Genome Browser
Species Human (GRCh38)
Location 5:2200209-2200231
Sequence ACGGTCTATTGGGCCAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985827038_985827049 30 Left 985827038 5:2200209-2200231 CCAGCTTTGGCCCAATAGACCGT No data
Right 985827049 5:2200262-2200284 CTCAGTTACCCCCTCATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985827038 Original CRISPR ACGGTCTATTGGGCCAAAGC TGG (reversed) Intergenic
No off target data available for this crispr