ID: 985827041

View in Genome Browser
Species Human (GRCh38)
Location 5:2200219-2200241
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985827041_985827049 20 Left 985827041 5:2200219-2200241 CCCAATAGACCGTGTCTTGGGCA No data
Right 985827049 5:2200262-2200284 CTCAGTTACCCCCTCATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985827041 Original CRISPR TGCCCAAGACACGGTCTATT GGG (reversed) Intergenic
No off target data available for this crispr