ID: 985827044

View in Genome Browser
Species Human (GRCh38)
Location 5:2200246-2200268
Sequence AACTGAGGTGTGGGACATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985827044_985827058 26 Left 985827044 5:2200246-2200268 CCCAGATGTCCCACACCTCAGTT No data
Right 985827058 5:2200295-2200317 CTCAAGATGCTCCCCGGCCTGGG No data
985827044_985827049 -7 Left 985827044 5:2200246-2200268 CCCAGATGTCCCACACCTCAGTT No data
Right 985827049 5:2200262-2200284 CTCAGTTACCCCCTCATGAATGG No data
985827044_985827055 20 Left 985827044 5:2200246-2200268 CCCAGATGTCCCACACCTCAGTT No data
Right 985827055 5:2200289-2200311 TGCCATCTCAAGATGCTCCCCGG No data
985827044_985827057 25 Left 985827044 5:2200246-2200268 CCCAGATGTCCCACACCTCAGTT No data
Right 985827057 5:2200294-2200316 TCTCAAGATGCTCCCCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985827044 Original CRISPR AACTGAGGTGTGGGACATCT GGG (reversed) Intergenic
No off target data available for this crispr